www YKHOANET

NGHIÊN CỨU Y KHOA

B́nh luận y khoa

Bài giảng thống kê sinh học - (Biostatistics)

Nghiên cứu khoa học

Thống kê R

Từ điển y khoa

Tạp chí y khoa

 

H́nh ảnh y khoa

Nội soi: Atlas h́nh ảnh nội soi đường hô hấp trên

Nội soi: Atlas h́nh ảnh nội soi cổ tử cung

MRI: Atlas h́nh ảnh MRI cột sống

 

GÓC SINH VIÊN Y KHOA

Atlas ykhoa

Thông tin sinh viên

Triệu chứng học nội khoa

Thông số Cận Lâm Sàng

 

TRƯỜNG  Y KHOA

ĐH Y Khoa Hà Nội

ĐH Y Dược TPHCM

ĐH Y Khoa Thái Nguyên

ĐH Y Khoa Huế

ĐH Y Khoa Thái B́nh

ĐH Y Tế Công Cộng

 

Phụ trách thường trực:
GS Nguyễn Văn Tuấn
TS Nguyễn Đ́nh Nguyên
BS Phan Xuân Trung

CHẨN ĐOÁN SỚM VÀ T̀M HIỂU GIAI ĐOẠN NHIỄM VIRÚT HUYẾT TRONG BỆNH DENGUE XUẤT HUYẾT BẰNG KỸ THUẬT RT/PCR

Vũ Thị Quế Hương1, Đỗ Quang Hà1, Nguyễn Trọng Lân2, Nguyễn Thanh Hùng2,

Vơ Đ́nh Thâm3, Claudine Roche4, Eliane Chungue4 và Vincent Deubel5.

Hội Vệ sinh Dịch tễ

 

I. MỞ ĐẦU

Virút Dengue (DEN) là tác nhân gây dịch quan trọng ở vùng nhiệt đới và cận nhiệt đới, người ta đă ước tính có trên 250.000 ca dengue xuất huyết (DXH) và ít nhất có 1 triệu ca sốt DEN đă xảy ra hàng năm(16). Ở Việt Nam trong hơn ba chục năm qua, DXH đă là vấn đề quan trọng cho sức khỏe cộng đồng. Các tỉnh phía Nam là vùng lưu hành dịch đă có số mắc và chết do DXH rất cao(8). Có 4 tưp virút DEN gây bệnh cho người qua vectơ trung gian là muỗi Aedes aegypti, hiện đă trải rộng khắp Đông Nam Á, châu Phi, Trung Nam Mỹ và Thái B́nh Dương. Có nhiều dạng lâm sàng khác nhau trong nhiễm trùng DEN ở trẻ con đi từ nhẹ đến nặng như: sốt không rơ nguyên nhân, sốt DEN cổ điển, DXH có hoặc không kèm choáng. Tỷ lệ tử vong do DXH tại các vùng lưu hành DEN từ <1% đến 40%(5). Về điều trị, không có cách nào khác hơn là bồi hoàn dịch một cách thận trọng(20) và để pḥng ngừa dịch không có biện pháp nào khác ngoài việc diệt muỗi. Do vậy, việc chẩn đoán sớm và nhanh chóng có ư nghĩa rất lớn đối với kết quả điều trị bệnh cũng như góp phần dự báo dịch sớm.

Nhiều tác giả đă ứng dụng phản ứng RT/PCR để phát hiện genome của virút DEN(4,6,12,13,17,19) từ chủng virút DEN hoặc từ các loại bệnh phẩm khác nhau (huyết thanh, dịch năo tủy, muỗi). Có tác giả đă chứng minh được độ nhạy cảm và độ đặc hiệu rất cao của phản ứng nhưng kỹ thuật quá phức tạp khó áp dụng được trong điều kiện nước ta(6,12). Có tác giả tŕnh bày phương pháp rất đơn giản, nhanh chóng nhưng lại chưa đánh giá được độ nhạy cảm của phản ứng trên huyết thanh BN mắc DXH(4,13,17). Do đó, sau khi xây dựng thành công kỹ thuật RT/PCR ở Labo Arbovirút - Viện Pasteur Tp.HCM năm 1995, chúng tôi tiến hành việc lượng giá kỹ thuật RT/PCR trên silica và semi-nested PCR với các primer đặc hiệu cho virút DEN của Lanciotti trong chẩn đoán bệnh DXH ở miền nam Việt nam cũng như trong t́m hiểu sinh bệnh học của DXH.

Mặt khác, trong sinh bệnh học DEN, phản ứng giữa kháng thể (KT) DEN tồn lưu và tế bào T là nội dung của giả thuyết miễn dịch tăng cường, đă giải thích tái nhiễm thường gây ra bệnh nặng hơn sơ nhiễm. Theo giả thuyết này, các KT không trung ḥa tồn lưu từ lần bị nhiễm DEN trước đó đă tạo thuận lợi cho virút xâm nhập vào tế bào đơn nhân và đại thực bào mang receptor Fc. Điều này làm tăng số lượng tế bào mang kháng nguyên (KN) hoạt hóa các tế bào T nhớ, dẫn đến sự phóng thích các hóa chất trung gian gây thất thoát huyết tương và làm tăng độ nặng của bệnh(11). Nghiên cứu này có mục đích t́m hiểu mối liên quan giữa đáp ứng KT và virút trong sinh bệnh học của DEN: Có phải có tưp virút DEN nào đó thường gây ra bệnh nặng hơn so với những tưp khác Có phải đáp ứng KT kiểu tái nhiễm có liên quan đến độ nặng của bệnh

II. PHƯƠNG PHÁP

1. Đối tượng nghiên cứu: là bệnh nhi (BN) được chẩn đoán lâm sàng là DXH theo tiêu chuẩn của Tổ chức Y tế thế giới, điều trị tại Khoa Sốt xuất huyết bệnh viện Nhi Đồng 1 (tháng 5 - 8/1995) và Nhi Đồng 2 (tháng 6 - 11/ 1996).


2. Cách lấy mẫu: Các mẫu máu cuả BN được lấy liên tiếp hàng ngày từ lúc nhập viện đến khi xuất viện, trung b́nh 1 BN lấy được 5 mẫu máu. Máu toàn phần được chuyển ngay trong lạnh đến labo Arbovirút viện Pasteur Tp.HCM. Tại đây, máu được quay ly tâm 2500 ṿng/phút - 20 phút ở 4oC, tách lấy huyết thanh, chia vào nhiều ống nghiệm nhỏ và cất -70oC cho tới khi làm xét nghiệm.

3. Phương pháp:

3.1. Chẩn đoán huyết thanh học:

Phản ứng ngăn ngưng kết hồng cầu (HI) và phản ứng miễn dịch men thu bắt IgM (MAC-ELISA) được tiến hành theo Clarke và Casal(2) và Kuno(15).

3.2. Phân lập virút trên nuôi tế bào muỗi ḍng C6/36:

Huyết thanh BN mắc DXH được cấy vào nuôi tế bào Aedes albopictus ḍng C6/36. Sau 7 ngày, tiến hành định loại virút bằng phản ứng miễn dịch huỳnh quang trực tiếp (DFA) dùng IgG kháng flavivirút gắn fluorescein isothiocyanate và gián tiếp (IFA) dùng các kháng thể đơn gịng Dengue-1 Hawaii 15F3-1-15 và D2-1F1-3, Dengue-2 NGC 3H5-1-21, Dengue-3 H87 5D4-11-24 và Dengue-4 H241 1H10-6-7 do Trung tâm pḥng chống dịch Colorado, Hoa Kỳ cung cấp.

3.3. RT/PCR trên silica: Tiến hành toàn bộ phản ứng trong 1 tube duy nhất.

3.3.1 Chiết xuất ARN: Từ 10 ml huyết thanh BN, ARN của virút được chiết xuất theo phương pháp Boom, HT được ly giải trong dung dịch L6 (chứa Guanidine isothiocyanate và Triton X-100) với sự hiện diện của silica. Sau đó, rửa cặn silica lần lượt với dung dịch L2 (chứa Guanidine isothiocyanate), ethanol 70% và dung dịch đệm RT lạnh.

Tŕnh tự gen của các primer oligonucleotide tổng hợp

Primers

Tŕnh tự gen

Chiều dài của sản phẩm PCR (bp)

D1(+)

TCAATATGCTGAAACGCGCGAGAAACCG

D1 - D2 = 511 bp

D2(-)

TTGCACCAACAGTCAATGTCTTCAGGTTC

 

TS1(-)

CGTCTCAGTGATCCGGGGG

D1 - TS1 = 482 bp

TS2(-)

CGCCACAAGGGCCATGAACAG

D1 - TS2 = 119 bp

TS3(-)

TAACATCATCATGAGACAGAGC

D1 - TS3 = 290 bp

TS4(-)

CTCTGTTGTCTTAAACAAGAGA

D1 - TS4 = 392 bp

D1, D2: primers dùng chung cho cả 4 tưp dengue.

TS1, TS2, TS3, TS4: primer đặc hiệu riêng cho từng tưp huyết thanh dengue.

3.3.2. Tổng hợp ADN bổ sung (cADN): Các đoạn mồi (primer) oligonucleotide được tổng hợp tại Unité de Chimie Organique của Viện Pasteur Paris. Primer D2 được bổ sung cho tŕnh tự gen chung của cả 4 tưp huyết thanh dengue. Sợi cADN đầu tiên có được bằng cách sao chép ngược
(reverse transcriptase=RT) ARN virút với 250 nmole primer D2 trong dd đệm RTS 10X, chứa 10 đơn vị RNasin (Promega), 250 mM dNTP và 6 đơn vị men sao chép ngược của virút gây u tủy ở chim (Promega) (AMV Rtase = avian myeloblastosis virus reverse transcriptase). Phản ứng này được ủ 1 giờ ở 42C.

3.3.3 Khuếch đại cADN bằng phản ứng PCR.

Sản phẩm cADN được cho vào 50 ml là thể tích cuối cùng chứa các dung dịch đệm Taq 10X (Gibco BRL), 25 mM MgCl2 (Gibco BRL), 5 mM dNTP, 50 pmoles primer D1, 50 pmoles primer D2 và 2 đơn vị men Thermus aquaticus (Taq) polymerase (Gibco BRL). Việc khuếch đại được thực hiện trong máy Crocodile III theo chương tŕnh 21 (gồm 1 chu kỳ biến tính = denaturation ở 94C - 3 phút, tiếp theo là 35 chu kỳ (biến tính = denaturation ở 94C - 30 giây, bắt cặp = annealing ở 53C - 90 giây và kéo dài = elongation ở 72C - 60 giây) và ở chu kỳ cuối cùng, mẫu được duy tŕ ở 72C - 10 phút.

3.4. Định tưp virút DEN bằng phản ứng "semi-nested-PCR" với các primers nucleotide đặc hiệu của Lanciotti.

4 ml sản phẩm PCR pha loăng 1:100 được cho vào 50 ml là thể tích cuối cùng của hỗn hợp khuếch đại (tương tự như trên) chỉ thay primer D2 bằng 4 primers (TS1, TS2, TS3 và TS4) đặc hiệu riêng cho từng tưp huyết thanh dengue. Sự khuếch đại được tiến hành trong máy Crocodile III theo chương tŕnh 22 (gồm 1 chu kỳ biến tính = denaturation ở 94C - 5 phút, tiếp theo là 25 chu kỳ (biến tính = denaturation ở 94C - 30 giây, bắt cặp = annealing ở 55C - 1 phút và kéo dài = elongation ở 72C - 2 phút) và ở chu kỳ cuối cùng, mẫu được duy tŕ ở 72C - 10 phút.

Điện di sản phẩm PCR lần 2 trên thạch 1,5 - 2 % trong TBE có chứa ethidium bromide 20 - 30 phút ở 120 volt và định tưp virút dengue dựa trên kích thước các dải ADN theo từng đôi base.

4. Các định nghĩa:

Ngày nói trong nghiên cứu được tính từ ngày BN bắt đầu sốt. Chỉ những BN đă được xác định bằng virút học hoặc huyết thanh học(8) mới được xếp vào nhóm nghiên cứu và chỉ tính thời gian nhiễm virút huyết trong những ca có RT-PCR dương tính.

- Phân tích so sánh các kết quả dựa trên các thử nghiệm thống kê c2-test và F-test với ngưỡng giá trị là 5%.

III. KẾT QUẢ

Từ tháng 5-8/1995 và tháng 6-11/1996, trong 110 BN được lựa chọn đă có 99 BN (90%) được chẩn đoán xác định nhiễm DEN bằng virút học và/hoặc huyết thanh học. Độ nặng nhẹ về lâm sàng cuả các BN này được ghi trong bảng 1, phần lớn BN có độ tuổi nằm trong khoảng 5-9 tuổi (53%), kế đó là lứa tuổi 10-14 (27%) và 0-4 (15%). BN nam (66%) nhiều hơn nữ (34%).

Bảng 1: Chẩn đoán lâm sàng, tuổi và giới tính của các BN là đối tượng nghiên cứu

Chẩn đoán ĐXH

Số BN

Tuổi trung b́nh, năm

Giới tính (% nam)

Nhiễm siêu vi

11

7,1 (1-10)

54

độ I

3

6,0 (5-7)

33

độ II

36

8,3 (2-15)

53

độ III

53

7,8 (0,66-15)

66

độ IV

7

7,3 (4-11)

57

Bảng 2: Tỷ lệ phân lập virút và RT-PCR dương tính cuả các BN bị sơ, tái nhiễm

Huyết thanh học

Số phân lập virút dương tính (%)

Số RT-PCR dương tính (%)

Sơ nhiễm

4 (20)

14 (70)

Tái nhiễm

5 (6,3)

27 (34,2)

Cộng

9 (9,1)

41 (41,4)

Bảng 3: So sánh khả năng phát hiện bệnh DXH của RT-PCR và Mac-ELISA.

Ngày sốt

Số HT thử nghiệm

Mac-ELISA (+)

RT-PCR (+)

2

1

1

0

3

7

2 (29%)

6 (86%)

4

24

10 (42%)

17 (71%)

5

51

22 (43%)

22 (43%)

6

50

28 (56%)

6 (12%)

7

50

31 (62%)

2 (4%)

8

48

32 (67%)

1 (2%)

9

43

27 (63%)

1 (2%)

010

32

24 (75%)

0

11

7

7 (100%)

0

Kết quả phân lập virút và RT-PCR được tŕnh bày trong bảng 2.

Ở 9 BN t́m ra virút th́ đồng thời cũng có RT-PCR dương tính. Hơn nữa, RT-PCR c̣n phát hiện thêm 32 ca mà phân lập virút cho kết quả âm tính. Khả năng phát hiện virút DEN bằng RT-PCR cao hơn phân lập virút khá nhiều, 41 ca RT-PCR (+) so với 9 chủng virút DEN được t́m ra. Kết quả này một lần nữa xác nhận RT-PCR có độ nhạy cảm cao trong chẩn đoán nhanh và sớm bệnh DXH (c2-test, p = 0,0000002)(19). Ngoài ra, trong nghiên cứu này c̣n thấy RT-PCR phát hiện virút DEN ở những BN bị sơ nhiễm cao hơn ca tái nhiễm (c2-test, p = 0,003) trong khi đó với kỹ thuật phân lập virút đă không t́m thấy sự khác biệt rơ rệt này (F-test, p = 0,07).

Kết quả cho thấy độ nhạy cảm rất cao của RT-PCR trong việc phát hiện bệnh DXH trong ṿng 4-5 ngày sau sốt. Ngược lại, với những mẫu huyết thanh lấy sau ngày sốt thứ 5 th́ Mac-ELISA cho tỷ lệ dương tính hơn hẳn. Điều này càng nêu bật lên ưu điểm của RT-PCR trong chẩn đoán sớm bệnh DXH so với các phương pháp chẩn đoán khác.

Các tưp virút gây bệnh của 41 BN phát hiện bằng RT-PCR được tŕnh bày trong bảng 4. Trong 1995, mẫu lấy ở BV Nhi Đồng I chủ yếu tập trung vào các BN có bệnh cảnh lâm sàng nặng, thường kèm sốc; v́ thế chúng tôi chỉ so sánh số liệu cuả các mẫu lấy ở BV Nhi Đồng 2, 1996. Về vai tṛ của các tưp DEN gây ra các bệnh cảnh lâm sàng của DXH, chúng tôi không t́m thấy mối tương quan có ư nghĩa thống kê giữa tưp virút và độ nặng nhẹ của bệnh (c2, P = 0,6) (Bảng 4), mặc dù tại bệnh viện Nhi Đồng 2, DEN-2 dường như gây ra sốc nhiều hơn DEN-1 và DEN-3.

Thời gian nhiễm virút huyết được phát hiện dài nhất là 9 ngày chỉ quan sát được trong 1 BN duy nhất bị nhiễm DEN-3. Trong khi đó, 90% BN (37/41) có thời gian nhiễm virút huyết kéo dài từ 4-6 ngày và thời gian nhiễm virút huyết trung b́nh của các ca nghiên cứu là khoảng 5 ngày.

Các số liệu trong bảng 6 cho thấy không có mối liên hệ rơ rệt giữa thời gian nhiễm virút huyết trung b́nh với độ nặng của bệnh đối với bất kỳ tưp virút DEN nào (F-test, p = 0,45).

Text Box: Bảng 4: Liên quan của các týp virút DEN với các độ lâm sàng nặng 
	BV NÐ1 (5-8/1995)	BV NÐ2 (6-11/1996)	Cộng
Týp virút	DXH có sốc	DXH không sốc	DXH có sốc	DXH không sốc	Týp virút	% sốc
DEN-1			2	4	6	33
DEN-2	9	1	4	5	19	68
DEN-3			4	12	16	25
Cộng	9	1	10	21	41	46

Mối liên quan giữa thời gian nhiễm virút huyết trung b́nh, t́nh trạng sơ tái nhiễm cuả BN và tưp virút được tŕnh bày trong bảng 7.

Ở những BN bị tái nhiễm, thời gian nhiễm virút huyết trung b́nh của cả 3 tưp DEN hơi ngắn hơn so với các BN bị sơ nhiễm, tuy nhiên sự khác biệt này không có ư nghĩa thống kê.

IV. BÀN LUẬN

Hai phương pháp chẩn đoán bệnh DXH trong pḥng thí nghiệm đáng tin cậy là phản ứng huyết thanh học và phân lập virút. Tuy nhiên, việc phân lập virút trên nuôi tế bào đ̣i hỏi thời gian ít nhất là 1 tuần và các phản ứng huyết thanh học chỉ được tiến hành sau khi có sự gia tăng hiệu giá kháng thể. V́ thế, các phương pháp này cho đến nay không giúp ích ǵ nhiều cho các nhà lâm sàng. Nhiều nhóm nghiên cứu DEN đă nhất trí về khả năng chẩn đoán nhanh bệnh DXH của phản ứng RT/PCR trên các mẫu HT BN mắc DXH với độ nhạy cảm là 75%(6) và 54%(12) và độ đặc hiệu là 100%(4,6,12,13). Do đó kết quả đạt được trong nghiên cứu này hoàn toàn phù hợp với các nghiên cứu trước đây.

Text Box: Bảng 5: Thời gian nhiễm virút phát hiện bằng kỹ thuật Silica RT-PCR
Thời gian nhiễm virút huyết (ngày)	Số ca	Tổng số ca
	DEN-1	DEN-2	DEN-3	
3	0	1	1	2
4	0	8	3	11
5	5	8	8	21
6	1	2	2	5
7	0	0	1	1
8	0	0	0	0
9	0	0	1	1
Tổng số ca	6	19	16	41
DMV	5,17 ? 0,40	4,58 ? 0,77	5,19 ? 1,38	4,9 ? 1,04
DMV: Thời gian nhiễm virút huyết trung bình tính bằng ngày.
Bảng 6: Mối tương quan giữa týp virút gây bệnh, thời gian nhiễm virút huyết và biểu hiện lâm sàng của bệnh
Ðộ lâm sàng 	DEN- 1	DEN- 2	DEN- 3	F test
	Số ca	DMV	Số ca	DMV	Số ca	DMV	(3 nhóm)
Ðộ I-II	4	5,3 ? 0,5	6	4,3 ? 0,8	12	5,2 ? 1,6	N.S. (p = 0,23)
Ðộ III-IV	2	5,0 ? 0,0	13	4,7 ? 0,8	4	5,3 ? 0,5	N.S. (p = 0,45)
Bảng 7: Liên quan giữa týp virút gây bệnh, sự đáp ứng miễn dịch của cơ thể và thời gian nhiễm virút huyết
Týp HT	Sơ nhiễm	Tái nhiễm	F-test 
	Số ca	DMV	Số ca	DMV	(2 nhóm)
DEN-1	4	5,3 ? 0,5	2	5,0 ? 0,0	N.S. (p=0,42)
DEN-2	6	4,7 ? 0,8	13	4,5 ? 0,8	N.S. (p=0,65)
DEN-3	4	5,8 ? 2,2	12	5,0 ? 1,0	N.S. (p=0,23)

Kỹ thuật chiết xuất ARN virút dựa trên Guanidine isothiocyanate và silica được tác giả Boom triển khai năm 1990(1) đă giúp rút ngắn được thời gian thử nghiệm. Đồng thời, các cặp primer đặc hiệu cho nhóm virút DEN và cho từng tưp virút DEN của Lanciotti(13) chứng tỏ có độ đặc hiệu rất cao (93% - 100% tùy theo tưp virút DEN). Do đó, trong điều kiện nước ta, việc ứng dụng hai kỹ thuật trên để chẩn đoán nhanh bệnh DXH là rất cần thiết. Hơn nữa, RT/PCR có giá trị lớn trong chẩn đoán nhanh các ca DXH nặng, khi lượng virút đă giảm nhiều trong máu nên phân lập virút phần lớn sẽ âm tính. Sự nhanh chóng của thử nghiệm RT/PCR trên silica (cho phép định tưp virút sau 10 giờ và chỉ cần lượng huyết thanh rất ít khoảng 10 l) cho thấy tính ưu việt của kỹ thuật này so với phương pháp phân lập virút dùng nuôi tế bào. Mặt khác, kỹ thuật RT/PCR trên silica phát hiện virút DEN từ huyết thanh BN, trong 4-5 ngày đầu khởi bệnh, nhạy gấp 10 lần so với kỹ thuật nuôi tế bào, phù hợp với kết quả của Deubel(6), trong những mẫu mà virút đă được chuẩn độ th́ PCR cũng nhạy gấp 20 lần hơn. Qua những kết quả sơ bộ như trên, chúng tôi có thể kết luận rằng RT/PCR trên silica góp phần quan trọng trong việc chẩn đoán nhanh bệnh DXH cũng như trong các nghiên cứu về sinh bệnh học bệnh sốt xuất huyết do virút DEN gây ra.

Nhiễm virút huyết là một khía cạnh quan trọng trong dịch tễ học của nhiễm trùng DEN nhưng chưa được khảo sát rộng răi. Điều quan trọng là v́ lượng virút lưu hành trong máu BN song hành với mật độ và tiềm năng của quần thể muỗi vectơ có ảnh hưởng đáng kể đến động lực lan truyền virút. Hơn nữa, mức độ nhiễm virút huyết ở BN có thể liên quan đến độ nặng của bệnh(10). Vaughn đă chứng minh rằng nhiễm virút huyết xuất hiện rất sớm trong giai đoạn sốt, giảm nhanh khi sốt hạ và kháng thể tăng(18). Kuberski và CS đă phân lập virút DEN-1 trong 73% BN vào ngày thứ 1 của bệnh và tỷ lệ giảm cho đến không thể phân lập được virút sau ngày thứ 6(14). Gubler cũng ghi nhận rằng phân lập virút dương tính ở ca sơ nhiễm thường gặp hơn ca tái nhiễm(9).

Kết quả phân lập virút của chúng tôi bị hạn chế do tùy thuộc rất nhiều vào việc lấy mẫu ở bệnh viện. Chúng tôi có rất ít mẫu máu lấy vào ngày thứ 3 của bệnh và đa số mẫu đầu tiên đều rơi vào ngày thứ 4 và thứ 5 của bệnh. Trong nghiên cứu này, chúng tôi đă sử dụng kỹ thuật RT-PCR để theo dơi thời gian nhiễm virút huyết của DEN. Thời gian nhiễm virút huyết điển h́nh của các BN ở đây là 4-5 ngày, đă phù hợp với các nghiên cứu trước đây(9,18). Tương tự như Gubler, Kuberski và Vaughn, số liệu của chúng tôi cũng cho thấy không có sự khác biệt có ư nghĩa thống kê giưă thời gian nhiễm virút huyết ở BN sơ nhiễm và tái nhiễm. Thời gian nhiễm virút huyết trung b́nh của cả 3 tưp DEN cũng gần giống nhau, hơi ngắn hơn ở BN nhiễm DEN-2 (4,6 ngày) và như nhau với DEN-1 và DEN-3 (5,2 ngày). Thời gian nhiễm virút trung b́nh của 41 BN là 5 ngày.

Có tác giả cho rằng có vài tưp virút như DEN-2 và DEN-3 dường như đă gây ra bệnh nặng hơn. Tuy nhiên ở Indonesia, Gubler đă không thể chứng minh mối liên quan giữa tưp virút với độ nặng nhẹ của bệnh và chúng tôi cũng t́m thấy kết quả tương tự trong nghiên cứu này. Khi các BN bị nhiễm với từng tưp virút riêng biệt, chúng tôi đă không thấy có sự khác nhau đáng kể nào trong thời gian nhiễm virút huyết giữa các BN bị DXH nhẹ và nặng.

Tuy nhiên, các nhận xét trên đây mới chỉ là bước đầu dựa trên 99 ca nghiên cứu. Chúng tôi hy vọng trong tương lai không xa với điều kiện vật chất kỹ thuật thuận lợi hơn sẽ cho phép chúng tôi tiếp tục nghiên cứu với số ca nhiều hơn và định lượng virút gây nhiễm để có thể rút ra những kết luận mang tính thuyết phục hơn.

Tài liệu tham khảo

1.        Boom, R., Sol, C.J.A., Salimans, M.M.M., Jansen, C.L., Wertheim-van-Dillen, P.M.E., Van der Noordaa, J. (1990): Rapid and simple method for purification of nucleic acids. J. Clin. Microbiol., 28: 495-503.

2.        Clarke, D., Casals, J. (1958): Techniques for hemagglutination and hemagglutination-inhibition with arthropod-borne viruses. Am. J. Trop. Med. and Hyg., 7:561-573.

3.        Chomczynski, P. and Sacchi, N. (1987): Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162: 156-159.

4.        Chungue, E., Roche, C., Lefervre, M.F., Barbazan, P., Chanteau, S. (1993): Ultra-Rapid, Simple, Sensitive, and Economical Silica Method for Extraction of Dengue Viral RNA From Clinical Specimens and Mosquitoes by Reverse Transcriptase-PCR. J. Med. Virol., 40: 142-145.

5.        Cohen S., Halstead S.B. (1966): Shock associated with dengue infection I. Clinical and physiologic manifestations of dengue hemorrhagic fever in Thailand, 1964. J. Pediatr., 68: 448-456.

6.        Deubel, V., Laille, M., Hugnot, J.P., Chungue, E., Guesdon, J.L., Drouet, M.T., Bassot, S. and Chevrier (1990): Identification of dengue sequences by genomic amplification: rapid diagnosis of dengue virus serotypes in peripheral blood. J. Virol. Methods, 30: 41-54.

7.        Do Quang Ha, Nguyễn Kim Tiến, Dinh Tuyết Hoa, Vu Thi Que Huong, Nguyen Trong Lan, Vo Dinh Tham, Nguyen Thi Hong (1989): Epidemic DHF in South Vietnam, 1987. Dengue Bulletin, WHO, 14: 46-57.

8.        Do Quang Ha, Vu Thi Que Huong, Huynh Thi Kim Loan, Pham Kim Sac (1996): Dengue Haemorrhagic Fever in South Vietnam, 1991-1994. Dengue Bulletin, 20: 55-61.

9.        Gubler D.J., Suharyono W., Tan R., Abidin, M., Sie, A. (1981): Viraemia in patients with naturally acquired dengue infection. Bull WHO, 59: 623-630.

10.     Gubler D.J., et al. (1978): Epidemiologic, clinical and virologic observations on dengue in the Kingdom of Tonga. Am. J. Trop. Med. Hyg. 27: 581-589.

11.     Halstead S.B., ORourke E.J. (1977): Dengue viruses and mononuclear phagocytes. I. Infection enhancement by non-neutralising antibody. J. Exp. Med., 146:201-217.

12.     Henchal, E.A., Polo, S.L., Vorndam, A.V., Yaemsiri, C., Innis, B.L., Hoke, C.H. (1991): Sensitivity and specificity of a universal primer set for the rapid diagnosis of dengue virus infections by polymerase chain reaction and nucleic acid hybridization. Am. J. Trop. Med. Hyg., 45: 418-428.

13.     Lanciotti, R.S., Calisher, C.H., Gubler, D.J., Chang, G.J., Vorndam, A.V. (1992): Rapid detection and typing of dengue viruses from clinical samples by using reverse transcriptase-polymerase chain reaction. J. Clin. Microbiol., 30: 545-551.

14.     Kuberski T., Rosen L., Reed D., Nataika J. (1977): Clinical and laboratory observations on patients with primary and secondary dengue type 1 infections with hemorrhagic manifestations in Fiji. Am. J. Trop. Med. Hyg., 26: 775-783.

15.     Kuno, G., Gomez, I., Gubler, D.J. (1987): Detecting artificial anti-dengue IgM immune complexes using an enzyme-linked immuno sorbent assay. Am. J. Trop. Med. Hyg., 36: 153-159.

16.     Monath T.P. (1994): Dengue: the risk to developed and developing countries. Proc. Natl. Acad. Sci. USA, 91: 2395.

17.     Morita. K., Maemoto, T., Honda, S. Onishi, K., Murata, M., Tanaka, M., Igarashi, A. (1994): Rapid Detection of Virus Genome From Imported Dengue Fever and Dengue Hemorrhagic Fever Patients by Direct Polymerase Chain Reaction. J. Med. Virol., 44: 54-58.

18.     Vaughn D.W., Green S., Kalayanarooj S., Innis B.L., Nimmannitya S., Suntayakorn S., Rothman A.L., Ennis F.A., Nisalak A. (1997): Dengue in the Early Febrile Phase: Viremia and Antibody Responses. The Journal of Infectious Diseases, 176: 322-330.

19.     Vu Thi Que Huong, Huynh Thi Kim Loan, Do Quang Ha, Nguyen Trong Lan, Nguyen Thanh Hùng, Vincent Deubel (1997): Detection of dengue virus by Reverse Transcription / Polymerase Chain Reaction. Med J HCM city , 2: 2-4 (in vietnamese).

20.     World Health Organization (1986): Dengue haemorrhagic fever: diagnostic, treatment and control. Geneva: WHO, 1-58.

 

Text Box: 1 VIỆN PASTEUR TP. HỒ CHÍ MINH 
 2, 3 BỆNH VIỆN NHI ÐỒNG 1 & 2 - GRALL,
4 VIỆN NGHIÊN CỨU Y HỌC LOUIS-MALARDÉ, TAHITI, 
5 VIỆN PASTEUR PARIS.


HỆ THỐNG PHẦN MỀM QUẢN LƯ BỆNH VIỆN


HT MEDSOFT

 

BS PHAN XUÂN TRUNG

"Lăng tử giữa thương trường"


 WHO definition of HEALTH:
Health is a state of complete physical, mental and social well-being and not merely the absence of disease or infirmity.



Hệ thống phần mềm quản lư bệnh viện
YKHOA.NET 2005

ASP.NET - Unicode - Web based
HIS - RIS/PACS - LIS - DIS - HL7 - DICOM - IDC10
E-prescribing
E-Patient-Record

QUẢN LƯ CHUYÊN MÔN

Quản lư viện phí

Toa thuốc thông minh

Chẩn đoán h́nh ảnh

Quản lư xét nghiệm

Bệnh án điện tử

Quản lư dược bệnh viện

Quản lư quầy thuốc tây

QUẢN LƯ HÀNH CHÁNH

QL nhân sự - tiền lương

QL vật tư - trang thiết bị

QL tài chánh - kế toán

Báo cáo - giám sát

 

 

Website YKHOANET.COM khai trương ngày 24/12/2000 - Năm thứ Tư.

Website YKHOANET - Y KHOA VIỆT NAM
www.ykhoanet.com www.ykhoa.net 

 In trang này     Phản hồi

Web Master: Dr PHAN XUAN TRUNG - drxuantrung@ykhoa.net